Archives of

Cheese, particularly Iranian white cheese, which is an integral part of the Iranian diet, has an annual consumption per capita of 5.4 kg (1). Iranian white cheese is a local brined cheese which is traditionally produced throughout the country. This close textured brined cheese is made from unpasteurized cow and sheep’s milk or mixtures of both without addition of any starter culture. Its flavor, body and texture are developed during the ripening period taking several weeks or months. Industrial Iranian white cheese is also made from ultra-filtered and pasteurized cow’s milk using mesophilic starter cultures and commercial microbial rennet. The main characteristics of this type of cheese are a minimum of 34% (w/w) total solids, a fat content of 15%, a protein content of 11% and a pH of 4.20-4.65. As expected, cheese may be contaminated with different types of bacteria; among which Staphylococcus aureus is one of the most important. This bacterium can gain an access to milk either by direct excretion from udders with clinical or subclinical mastitis, or by cross contamination and raw milk processing (2,3).
Staphylococcus aureus is an opportunistic human pathogen considered as the third most common pathogen causing food poisoning in the world. Staphylococcal food poisoning, which is caused by ingestion of foods containing enterotoxins, is one of the most prevalent causes of gastroenteritis worldwide (2-4). Moreover, because of the expanded use and misuse of antibiotics in the treatment of human and animal diseases, antibiotic resistance is increasing as a major concern for public health. On the other hand, high consumption of antibiotic in the community can be a major problem in treatment. Staphylococcus aureus strains may show single or multiple antibiotic resistances representing a major threat for human and animals’ health (4-8). Β-lactams (e.g. penicillins, cephalosporins) are some major groups of antibiotics that because of their massive use, antibiotic resistance against them has continually been increasing. Methicillin is one of latest antibiotics of this group and resistance against it can be very important.  The Staphylococcus aureus isolates are divided into two groups: methicillin-resistant Staphylococcus aureus (MRSA); and methicillin-susceptible Staphylococcus aureus (MSSA). Thus, the presence of such MRSA strains in cheese samples could be a major concern on safety and quality of traditionally produced cheese. Methicillin-resistance is mediated by the mecA gene which encodes a penicillin binding protein, PBP2a, with reduced affinity for β-lactams (9,10).
Therefore, the mecA gene is considered as a useful molecular marker to identify methicillin resistance in all staphylococci. Other chromosomally determined factors, such as the femA operon that act as regulator genes, are essential for the expression of methicillin-resistance in S. aureus (11), as well. The femA gene is also a molecular marker for genotypic identification of S. aureus species and is universally present in all S. aureus isolates (12). In fact, simultaneous detection of femA and mecA genes is advantageous in identifying the species and genotypic methicillin resistance of S. aureus.
 Aims of the study:
This study was aimed to investigate antibiotic sensitivity and methicillin resistance gene in Staphylococcus aureus isolated from traditional Iranian white cheese, Hamedan province, Iran, during 2015.
 

Materials & Methods

Sampling: This cross-sectional study was conducted during 2015. A total of 120 cheese samples consisting traditional (60) and industrial (60) Iranian white cheese were purchased from central dairy markets in Hamedan province, located in the west of Iran. All samples were packed in sterile conditions and kept at 4°C prior for analysis, which began immediately after the transportation of samples to food hygiene laboratory, faculty of veterinary science, Bu-Ali Sina University.
Bacterial culture
Isolation of S. aureus from cheese samples was performed according to ISO 68881 (13). Initially, samples were homogenized, then 10 g from each sample was diluted with 90 ml of 0.1% sterile peptone water. Using Baird-Parker agar medium supplemented with egg yolk-tellurite emulsion, 0.1 ml of the dilution was streaked on the medium and incubated at 37°C for 24 to 48 h. The black colonies with bright halos were selected as S. aureus were identified by conventional methods, including Gram staining, production of coagulase, catalase, DNase, fermentation of mannitol and other biochemical tests. The identified strains were kept frozen at -20°C in Nutrient broth containing 30% glycerol until PCR confirming.
Extraction of DNA samples
DNA was extracted from each of the isolated S. aureus strains, using a previously described protocol (14). Briefly, about 3 ml of an overnight Nutrient broth culture of each of the bacterial isolates was transferred into a microtube and the bacterial cells were precipitated at 8000 rpm for 3 min. Afterward, 200 µl of a lysis buffer (1% Triton X-100, 0.5% Tween 20, 10 mM Tris-HCl, 1 mM EDTA, pH=8.0) was added to the pellets and microtubes were incubated in a boiling water bath (100°C) for 10 min followed by being centrifuged at 10000 rpm for 2 min. The supernatants were transferred into clean microtubes and 3-5 µl of each sample was used as template DNA in PCR assays.
Multiplex PCR
Extracted DNA samples from S. aureus isolates were examined by a multiplex PCR assay targeting two genes, femA and mecA, to genetically detect S. aureus species and MRSA strains simultaneously. The oligonucleotide primers were previously described by Mehrotra et al. (2000) and their sequences presented in table 1. The PCR reaction (25 μl) contained 4-5 μl of template DNA, 2.5 µl of 10× PCR buffer, 0.75 µl of 50 mM MgCl₂, 0.5 µl of 10 mM dNTPs, 0.25 µl of 5 U/µl of Taq DNA polymerase, and 10 pmol of each of the primers. The PCR amplification was performed under the following conditions: initial denaturation at 94°C for 5 min followed by denaturation at 94°C for 2 min, annealing at 57°C for 2 min, extension at 72°C for 1 min (35 cycles) and a final extension at 72°C for 7 min (12). The products of PCR were analyzed by electrophoresis on 2.5% agarose gel containing ethidium bromide (0.5 μg/ml).
 

Table 1) Primer pairs used in PCR assays

Primer	Sequence 5’- 3’	Product size (bp)
mecA-forward	ACTGCTATCCACCCTCAAAC	163
mecA-reverse	CTGGTGAAGTTGTAATCTGG
femA-forward	AAAAAAGCACATAACAAGCG	132
femA-reverse	GATAAAGAAGAAACCAGCAG

Antimicrobial susceptibility testing
Antibiotic resistance of isolated S. aureus strains were tested by applying a Kirby-Bauer disk diffusion assay according to the guidelines of CLSI (15). All identified S. aureus strains were tested for a panel of antibiotics including penicillin (10 unite), oxacillin (30 μg), streptomycin (10μg), tetracycline (30 μg), cefoxitin (30 μg), gentamycin (10 μg), vancomycin (30 μg), chloramphenicol (30 μg), ciprofloxacin (5 μg), carbenicillin (100 μg), doxycycline (30 μg), kanamycin (30 μg), and cefixime (5μg). S. aureus (ATCC 33591) and a methicillin-resistant S. aureus (ATCC 6538) were used as negative (MSSA strain) and positive controls, respectively. Zones of growth inhibition were measured after an overnight incubation. Resistance or susceptibility to the antibiotics was interpreted as suggested by standard method.
 

Results

Based on the bacterial culture methods, 19 out of 120 cheese samples (15.8%) were contaminated with S. aureus. All of them in which they were isolated from traditional white and no S. aureus was seen in industrial cheese samples. Considering each group separately, out of the 60 industrial Iranian white cheese and 60 traditional white cheese samples examined, 0 (0%) and 19 (31.67%) were contaminated with S. aureus, respectively (Table 2).
The expected DNA fragment (132 bp), representing the presence of femA gene, was amplified from all of the phenotypically characterized S. aureus strains in PCR examination. Among these strains, the mecA gene was only detected in 4 isolates by PCR and genotypically confirmed as MRSA strains (Fig. 1). However, 3 out of these 4 strains were shown to be resistant to oxacillin (a representative antibiotic for determination of resistance to methicillin) in antimicrobial sensitivity test. As shown in Table 3, the highest antibiotic resistance rate was observed against penicillin (100%), while the lowest resistance rate belonged to kanamycin (5.26%) and ciprofloxacin (5.26%). None of the strains was resistant to vancomycin. As mentioned, 3 (15.79%) out of these 19 S. aureus isolates were identified as MRSA strains where the bacteria showed resistance against oxacillin.
 

 
Table 2) Distribution of isolated S. aureus in the two sample groups

samples	No	Isolates (%)	mecA positive (%)
Industrial white cheese	60	0	0
Traditional white cheese	60	19 (31.67)	4 (21.05)

 
Table 3) Antibiotic sensitivity patterns in S. aureus isolated from cheese samples.

Antibiotic	Resistant N (%)	Intermediate N (%)	Sensitive N (%)
penicillin (10 U)	19 (100)	0	0
ciprofloxacin (5 μg)	1 (5.26)	2 (10.52	16 (84.21)
oxacillin (30 μg)	4 (21.05)	0	15 (78.94)
chloramphenicol (30 μg)	10 (52.36)	1 (5.26)	8 (42.10)
carbenicillin (100 μg)	3 (15.79)	5 (26.31)	11 (57.89)
gentamycin (10 μg)	4 (21.05	0	15 (78.94)
vancomycin (30 μg)	0	0	19 (100)
doxycycline (30 μg)	2 (10.52	1 (5.26)	16 (84.21)
streptomycin (10 μg)	2 (10.52)	8 (42.1)	9 (47.36)
tetracycline (30 μg)	2 (10.52)	0	17 (89.47)
cefixime (5 μg)	10 (52.36)	6 (31.57)	3 (15.78)
kanamycin (30 μg)	1 (5.26)	2 (10.52)	16 (84.21)
cefoxitin (30 μg)	2 (10.52)	2 (10.52)	15 (78.94)

 
 
 

Figure 1) the results of electrophoresis of PCR products. Lane L: 100 bp DNA ladder, Lane 1: S. aureus (ATCC 33591) containing amplified DNA fragments from both femA and mecA genes (132 and 163 bp, respectively) as positive control. Lane 2: S. aureus (ATCC 6538) containing amplified DNA fragments from only femA gene (132 bp). Lane 3: a tested isolate which was positive for both genes. Lane 4: a S. aureus isolate which was negative for mecA gene. Lane 5: negative control containing no template DNA.